View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_660 (Length: 220)
Name: NF10481A_low_660
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_660 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 113; Significance: 2e-57; HSPs: 5)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 22 - 142
Target Start/End: Complemental strand, 33593408 - 33593288
Alignment:
| Q |
22 |
aggcccatcatcccccactccccaacatttatgagaaaaaccagttgtgcttgactttatttttcgttgttttgcaaaacatgaaagggaaatgatttgg |
121 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33593408 |
aggcccatcatcccctactccccaacatttatgagaaaaaccagttgtgcttgactttatttttcgttgttttgcaaaacatgaaagggaaatgatttgg |
33593309 |
T |
|
| Q |
122 |
agtttccctcttgcttgtttt |
142 |
Q |
| |
|
||||||||||||| ||||||| |
|
|
| T |
33593308 |
agtttccctcttgtttgtttt |
33593288 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 22 - 142
Target Start/End: Complemental strand, 33600539 - 33600419
Alignment:
| Q |
22 |
aggcccatcatcccccactccccaacatttatgagaaaaaccagttgtgcttgactttatttttcgttgttttgcaaaacatgaaagggaaatgatttgg |
121 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33600539 |
aggcccatcatcccctactccccaacatttatgagaaaaaccagttgtgcttgactttatttttcgttgttttgcaaaacatgaaagggaaatgatttgg |
33600440 |
T |
|
| Q |
122 |
agtttccctcttgcttgtttt |
142 |
Q |
| |
|
||||||||||||| ||||||| |
|
|
| T |
33600439 |
agtttccctcttgtttgtttt |
33600419 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 163 - 220
Target Start/End: Complemental strand, 33593290 - 33593233
Alignment:
| Q |
163 |
tttgcaaccatagacgcaggtctgcgagatttccaaagcaaatttgccttaattttta |
220 |
Q |
| |
|
|||||||||| | ||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
33593290 |
tttgcaaccacaaacgcaggtctgcgagatttccaaagcaaatttgacttaattttta |
33593233 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 163 - 220
Target Start/End: Complemental strand, 33600421 - 33600364
Alignment:
| Q |
163 |
tttgcaaccatagacgcaggtctgcgagatttccaaagcaaatttgccttaattttta |
220 |
Q |
| |
|
|||||||||| | ||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
33600421 |
tttgcaaccacaaacgcaggtctgcgagatttccaaagcaaatttgacttaattttta |
33600364 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 78 - 204
Target Start/End: Complemental strand, 33586096 - 33585975
Alignment:
| Q |
78 |
ttatttttcgttgttttgcaaaacatgaaagggaaatgatttggagtttccctcttgcttgttttcgtgtctgattggtttggagtttgcaaccatagac |
177 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||| | ||||||||| ||||||| ||| ||| ||| |||||| |||||||||| | | |
|
|
| T |
33586096 |
ttatttttcgttgttttgcaaaacatgacagggaaatga-----aagctccctcttgtttgttttagtgcctgtttgatttggaatttgcaaccacaaat |
33586002 |
T |
|
| Q |
178 |
gcaggtctgcgagatttccaaagcaaa |
204 |
Q |
| |
|
||| |||||| ||||||||||||||| |
|
|
| T |
33586001 |
gcatgtctgcaggatttccaaagcaaa |
33585975 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University