View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_663 (Length: 219)
Name: NF10481A_low_663
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_663 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 24 - 201
Target Start/End: Complemental strand, 54261350 - 54261173
Alignment:
| Q |
24 |
atcacagagcgaaacaagtaattaagagtttgatctttcaaacttttgctaatttcctttactcttataaattagtaaacaattgaactttgaatactga |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54261350 |
atcacagagcgaaacaagtaattaagagtttgatccttcaaacttttgctaatttcctttactcttataaattagtaaacaattgaactttgaatactga |
54261251 |
T |
 |
| Q |
124 |
gaacacaagatatacgccctatctggataaacagcttaatttgcaattataacttatgcgcttatgtattagctattt |
201 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54261250 |
gaacacaagatatacgccctatatggataaacagcttaatttgcaattataacttatgcgcttatgtattagctattt |
54261173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University