View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10481A_low_673 (Length: 216)

Name: NF10481A_low_673
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10481A_low_673
NF10481A_low_673
[»] chr5 (2 HSPs)
chr5 (19-140)||(9462211-9462349)
chr5 (166-194)||(9462363-9462391)


Alignment Details
Target: chr5 (Bit Score: 71; Significance: 2e-32; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 71; E-Value: 2e-32
Query Start/End: Original strand, 19 - 140
Target Start/End: Original strand, 9462211 - 9462349
Alignment:
19 cagagagtagagtgaataattctgagatctcaaactaagatgattaacaactaatgaacttgaacaatt-----------------gtttattcatttaa 101  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||                 ||||||||||||||    
9462211 cagaaagtagagtgaataattctgagatctcaaactaagatgattaacaaataatcaacttgaacaattattaatgttgcttgcaggtttattcatttaa 9462310  T
102 ttaaaactgtagcacctgatgcagaaaactatgcagaag 140  Q
    |||||||||||||||||||||||||||||||||||||||    
9462311 ttaaaactgtagcacctgatgcagaaaactatgcagaag 9462349  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 166 - 194
Target Start/End: Original strand, 9462363 - 9462391
Alignment:
166 gctcgctaagcgatcatttctgttatgac 194  Q
    |||||||||||||||||||||||||||||    
9462363 gctcgctaagcgatcatttctgttatgac 9462391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University