View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_678 (Length: 215)
Name: NF10481A_low_678
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_678 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 45; Significance: 8e-17; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 136 - 188
Target Start/End: Complemental strand, 29517844 - 29517792
Alignment:
| Q |
136 |
cagattcgctggaaatctctggaatctcttagcagcagaggaatcaacaccat |
188 |
Q |
| |
|
|||||| | |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29517844 |
cagattggatggaaatctctggaatctcttagcagcagaggaatcaacaccat |
29517792 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 15 - 62
Target Start/End: Complemental strand, 29517969 - 29517922
Alignment:
| Q |
15 |
gacatcactacaaacttaaatgcattaaacaaagcatagcattttcca |
62 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29517969 |
gacataactacaaacttaaatgcattaaacaaagcatagcattttcca |
29517922 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University