View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10481A_low_680 (Length: 214)

Name: NF10481A_low_680
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10481A_low_680
NF10481A_low_680
[»] chr4 (1 HSPs)
chr4 (19-200)||(3246588-3246768)


Alignment Details
Target: chr4 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 19 - 200
Target Start/End: Original strand, 3246588 - 3246768
Alignment:
19 acatcaaacattttaacgctgcgatctagatcacactagtggaccttggtagaaaacatctagagcacgaggttcgtagaattaggataaaaagacacaa 118  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||    
3246588 acatcaaacattttaacgccgcgatctagatcacactagtggaccttggtagaaaacatctagagcacgaggttcgtagaattaggataaaattacacaa 3246687  T
119 ttgttttctagtttaattagatgtctcgagtttgtgttttgaaaatgcaacaaggttggaatgtttcgagggtcgtgatacc 200  Q
    ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
3246688 ttg-tttctagtttaattagatgtctcgagtttgtgttttgaaaatgcaacaaggttggaatatttcgagggtcgtgatacc 3246768  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University