View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_682 (Length: 214)
Name: NF10481A_low_682
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_682 |
 |  |
|
| [»] scaffold0265 (2 HSPs) |
 |  |  |
|
| [»] scaffold0002 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 96 - 194
Target Start/End: Original strand, 18334844 - 18334942
Alignment:
| Q |
96 |
atagccgttggttggttaggacatcctatctttagagacaaagaggggcgtgaactttttgtacgtcgtatgcctacnnnnnnngaaacatttccggtt |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
18334844 |
atagccgttggttggttaggacatcctatctttagagacaaagaggggcgtgaactttttgtacgtcgtatgcctactttttttgaaacatttccggtt |
18334942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 76; Significance: 3e-35; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 96 - 171
Target Start/End: Original strand, 43000 - 43075
Alignment:
| Q |
96 |
atagccgttggttggttaggacatcctatctttagagacaaagaggggcgtgaactttttgtacgtcgtatgccta |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43000 |
atagccgttggttggttaggacatcctatctttagagacaaagaggggcgtgaactttttgtacgtcgtatgccta |
43075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 102 - 166
Target Start/End: Complemental strand, 18151833 - 18151769
Alignment:
| Q |
102 |
gttggttggttaggacatcctatctttagagacaaagaggggcgtgaactttttgtacgtcgtat |
166 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
18151833 |
gttggttggttagaacatcctatctttagagacaaagatgggcgtgaactttatgtacgtcgtat |
18151769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 96 - 169
Target Start/End: Complemental strand, 18159318 - 18159245
Alignment:
| Q |
96 |
atagccgttggttggttaggacatcctatctttagagacaaagaggggcgtgaactttttgtacgtcgtatgcc |
169 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |||||||||| |||||| ||||||||||| |||||||| |
|
|
| T |
18159318 |
atagtcgttggttggttaggacatcctatctttaaagacaaagagaagcgtgagctttttgtacgacgtatgcc |
18159245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 74; Significance: 4e-34; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 20 - 97
Target Start/End: Complemental strand, 34915974 - 34915897
Alignment:
| Q |
20 |
taattttcaacttagcgtcatgtaagttatttgatctttaatagtattatggaaaactggtataatattcatggttat |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
34915974 |
taattttcaacttagcgtcatgtaagttatttgatctttaatagtattatggaaaactggtatgatattcatggttat |
34915897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 37 - 88
Target Start/End: Complemental strand, 34544589 - 34544538
Alignment:
| Q |
37 |
tcatgtaagttatttgatctttaatagtattatggaaaactggtataatatt |
88 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
34544589 |
tcatgtaagttatttgatctttaatagtattatggaaaactggtatattatt |
34544538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 20 - 61
Target Start/End: Complemental strand, 34538850 - 34538809
Alignment:
| Q |
20 |
taattttcaacttagcgtcatgtaagttatttgatctttaat |
61 |
Q |
| |
|
||||||||||| |||| ||||||||||||||| ||||||||| |
|
|
| T |
34538850 |
taattttcaacatagcatcatgtaagttatttcatctttaat |
34538809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0265 (Bit Score: 63; Significance: 1e-27; HSPs: 2)
Name: scaffold0265
Description:
Target: scaffold0265; HSP #1
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 107 - 194
Target Start/End: Complemental strand, 2472 - 2385
Alignment:
| Q |
107 |
ttggttaggacatcctatctttagagacaaagaggggcgtgaactttttgtacgtcgtatgcctacnnnnnnngaaacatttccggtt |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
2472 |
ttggttaggacatcctatctttagagacaaataggggcgtgaactttttgtacgtcgtatgcctactttttttgaaacatttccggtt |
2385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0265; HSP #2
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 107 - 194
Target Start/End: Complemental strand, 7361 - 7274
Alignment:
| Q |
107 |
ttggttaggacatcctatctttagagacaaagaggggcgtgaactttttgtacgtcgtatgcctacnnnnnnngaaacatttccggtt |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
7361 |
ttggttaggacatcctatctttagagacaaataggggcgtgaactttttgtacgtcgtatgcctactttttttgaaacatttccggtt |
7274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 63; Significance: 1e-27; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 107 - 194
Target Start/End: Original strand, 21825449 - 21825536
Alignment:
| Q |
107 |
ttggttaggacatcctatctttagagacaaagaggggcgtgaactttttgtacgtcgtatgcctacnnnnnnngaaacatttccggtt |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
21825449 |
ttggttaggacatcctatctttagagacaaataggggcgtgaactttttgtacgtcgtatgcctactttttttgaaacatttccggtt |
21825536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 96 - 194
Target Start/End: Original strand, 270076 - 270174
Alignment:
| Q |
96 |
atagccgttggttggttaggacatcctatctttagagacaaagaggggcgtgaactttttgtacgtcgtatgcctacnnnnnnngaaacatttccggtt |
194 |
Q |
| |
|
||||| ||||| |||||||||||||| |||||||||| ||||| || ||||| ||||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
270076 |
atagctgttggatggttaggacatcccgtctttagagataaagaaggacgtgagctttttgtacgccgtatgcctactttttttgaaacatttccggtt |
270174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University