View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_693 (Length: 212)
Name: NF10481A_low_693
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_693 |
 | |
|
| [»] scaffold0147 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0147 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: scaffold0147
Description:
Target: scaffold0147; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 1 - 80
Target Start/End: Original strand, 2466 - 2545
Alignment:
| Q |
1 |
taattgttattattatttggtcatttctgattctgggtctattatcttattccaggtttttgttcttatctttattcaat |
80 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
2466 |
taattgttattattatttggtcatttctgattctgggtctattatcttattccaggtttttgttcttatctttaatcaat |
2545 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0147; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 160 - 197
Target Start/End: Original strand, 2625 - 2662
Alignment:
| Q |
160 |
atatctcagtttgactgaagtcatgttgttaagttgat |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2625 |
atatctcagtttgactgaagtcatgttgttaagttgat |
2662 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 1 - 80
Target Start/End: Original strand, 3451685 - 3451764
Alignment:
| Q |
1 |
taattgttattattatttggtcatttctgattctgggtctattatcttattccaggtttttgttcttatctttattcaat |
80 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
3451685 |
taattgttattattatttggtcatttctgattctgggtctattatcttattccaggtttttgttcttatctttaatcaat |
3451764 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 160 - 197
Target Start/End: Original strand, 3451844 - 3451881
Alignment:
| Q |
160 |
atatctcagtttgactgaagtcatgttgttaagttgat |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3451844 |
atatctcagtttgactgaagtcatgttgttaagttgat |
3451881 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University