View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_696 (Length: 211)
Name: NF10481A_low_696
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_696 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 20 - 195
Target Start/End: Original strand, 44463942 - 44464117
Alignment:
| Q |
20 |
ggagtgaggcatggctatgcgtgtttattgttatatgtatattccggcctcactgcttgttgcagagatttttgtcaggttttttatttggggtgttccg |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
44463942 |
ggagtgaggcatggctatgcgtgtttattgttatatgtatattccggcctcactgcttgttgcagagatttttgttaggttttttatttggggtattcca |
44464041 |
T |
|
| Q |
120 |
tatatatacgacatctttgtattttttccttctgccacgagttttagtgcttcttgcacttactcgtcgagaataa |
195 |
Q |
| |
|
|||||||||| ||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44464042 |
tatatatacggcatctttgtattttttctttcttccacgagttttagtgcttcttgcacttactcgtcgagaataa |
44464117 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University