View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_70 (Length: 398)
Name: NF10481A_low_70
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_70 |
 | |
|
| [»] scaffold0002 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0002 (Bit Score: 319; Significance: 1e-180; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 319; E-Value: 1e-180
Query Start/End: Original strand, 19 - 369
Target Start/End: Original strand, 336929 - 337279
Alignment:
| Q |
19 |
ggaagttccaatagtcatgcatccccaacaagtgcagcgagcattccacgatctccttcttccaactctaatcaacaacttcttgctcaaaggaaattgt |
118 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
336929 |
ggaagttccaatagtcatgcatctccaacaagtgcagcgagcattccacgatctccttcttccaactctaatcaacaacttcttgctcaaaggaaattgt |
337028 |
T |
|
| Q |
119 |
ttgcagaatcccaaataggaagatccagttctcagaagcttttggagccaaaactccctcagcttcctggaattgctccttatagaattggcctcgggaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
337029 |
ttgcagaatcccaaataggaagatccagttttcagaagcttttggagccaaaactccctcatcttcctggaattgctccttatagaattgtccttgggaa |
337128 |
T |
|
| Q |
219 |
tgtaaaagataaggtatcccttctgaattctgatctactctaataatatatgttaactggatctgcatgtatggacactagtatttcattcctacattta |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
337129 |
tgtaaaagataaggtatcccttctgaattctgatctactctaataatatatgttaactggatctgcatgtatggacactagtatttcatttctacatttg |
337228 |
T |
|
| Q |
319 |
cttttgatgtgctgtaatgagtgattcatatctaaacattttactgaacaa |
369 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
337229 |
cttttgatgtgctgtagtgagtgattcatatctaaacattttactgaacaa |
337279 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 54; Significance: 7e-22; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 142 - 235
Target Start/End: Original strand, 42172507 - 42172600
Alignment:
| Q |
142 |
tccagttctcagaagcttttggagccaaaactccctcagcttcctggaattgctccttatagaattggcctcgggaatgtaaaagataaggtat |
235 |
Q |
| |
|
||||||| |||||| |||||||||||| | |||||||| |||||||||||||||||||||||| ||| ||| || |||||||| |||||||||| |
|
|
| T |
42172507 |
tccagttttcagaaacttttggagccacagctccctcaacttcctggaattgctccttatagagttgtcctgggaaatgtaaaggataaggtat |
42172600 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University