View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_708 (Length: 208)
Name: NF10481A_low_708
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_708 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 21 - 190
Target Start/End: Complemental strand, 54261342 - 54261173
Alignment:
| Q |
21 |
gcgaaacaagtaattaagagtttgatctttcaaacttttgctaatttcctttactcttataaattagtaaacaattgaactttgaatactgagaacacaa |
120 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54261342 |
gcgaaacaagtaattaagagtttgatccttcaaacttttgctaatttcctttactcttataaattagtaaacaattgaactttgaatactgagaacacaa |
54261243 |
T |
|
| Q |
121 |
gatatacgccctatctggataaacagcttaatttgcaattataacttatgcgcttatgtattagctattt |
190 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54261242 |
gatatacgccctatatggataaacagcttaatttgcaattataacttatgcgcttatgtattagctattt |
54261173 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University