View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_718 (Length: 206)
Name: NF10481A_low_718
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_718 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 17 - 156
Target Start/End: Original strand, 10274649 - 10274788
Alignment:
| Q |
17 |
aaatgaaatagggtaatgataaaatgaagttagataaagaaaagttcataaaaagccaaagactaatgaagtggaaataaactttggcttacataagcaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10274649 |
aaatgaaatagggtaatgataaaatgaagttagataaagaaaagttcataaaaagccaaagactaatgaagtggaaataaactttggcttacataagcaa |
10274748 |
T |
|
| Q |
117 |
aatgtgtcatccaaacttaaccgttcatttacaatttctt |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10274749 |
aatgtgtcatccaaacttaaccgttcatttacaatttctt |
10274788 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 17 - 88
Target Start/End: Original strand, 10266734 - 10266805
Alignment:
| Q |
17 |
aaatgaaatagggtaatgataaaatgaagttagataaagaaaagttcataaaaagccaaagactaatgaagt |
88 |
Q |
| |
|
||||||||| |||||| |||||||| |||||||||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
10266734 |
aaatgaaatggggtaacgataaaataaagttagataaagaaatgttcagaaaaagccaaagactaatgaagt |
10266805 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University