View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_729 (Length: 204)
Name: NF10481A_low_729
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_729 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 14 - 183
Target Start/End: Complemental strand, 37427852 - 37427683
Alignment:
| Q |
14 |
gatggacatctaggagacagtgtaccgtcatatttgcaaaagcatctcttttctaatatcttgaaggaagtgagttgttgaatcaagctaaagatattat |
113 |
Q |
| |
|
|||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
37427852 |
gatggacacctgggagacagtgtaccgtcatatttgcaaaagcatctcttttctaatatcttgaaggaagtgagttgttgaaacaaactaaagatattat |
37427753 |
T |
|
| Q |
114 |
gtattggttattgcctcacatttgatttcttcggaaaagggcttttcttcctttctattttatgttgtct |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37427752 |
gtattggttattgcctcacatttgatttcttcggaaaagggcttttcttcctttctattttatgttgtct |
37427683 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 44 - 89
Target Start/End: Original strand, 1664661 - 1664706
Alignment:
| Q |
44 |
tatttgcaaaagcatctcttttctaatatcttgaaggaagtgagtt |
89 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
1664661 |
tatttacaaaaacatctcttttctaatatcttgaaggaagtgagtt |
1664706 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University