View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_730 (Length: 203)
Name: NF10481A_low_730
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_730 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 134; Significance: 6e-70; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 10 - 182
Target Start/End: Original strand, 20217512 - 20217685
Alignment:
| Q |
10 |
aaaatagattgttagtatatagacatgtaatttgaattgagacaaaaatgaaaaataa-tggagtaatacatctgtacaaactgcaacgaaaaaaggcct |
108 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| ||| |||||||||||| || |||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
20217512 |
aaaatagattgttagtatatagacaggtaatttgaattcagataaaaatgaaaaaaaaatggagtaatacatctgtacaaactgcaacgaaaaaaggtct |
20217611 |
T |
 |
| Q |
109 |
attagattcaagtgtcatgtttggagtgacgctgcaattgactgatatttgatctggttgtattatagttatag |
182 |
Q |
| |
|
||||||||||||||||||| ||||||| |||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
20217612 |
attagattcaagtgtcatgattggagtcacgctgcaattgactgatgtttgatctggttgtattatagttatag |
20217685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University