View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_734 (Length: 203)
Name: NF10481A_low_734
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_734 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 16 - 168
Target Start/End: Original strand, 48399477 - 48399629
Alignment:
| Q |
16 |
ctccaaacaatcaaatttgagtttttacctcaacttattttgcctagatggaatcgacttgtaacctcaagttttaccattttgatcttttatttgaaat |
115 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48399477 |
ctccaagcaatcaaatttgagtttttacctcaacttattttgcctagatggaatcgacttgtaacctcaagttttaccattttgatcttttatttgaaat |
48399576 |
T |
 |
| Q |
116 |
tatggttaaattatttaactaatgatattttaaagtcttatatgttatgtcat |
168 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48399577 |
tatggttaaattatttaactaatgatattttaaagtcttatatgttatgtcat |
48399629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 120 - 156
Target Start/End: Complemental strand, 42111640 - 42111604
Alignment:
| Q |
120 |
gttaaattatttaactaatgatattttaaagtcttat |
156 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
42111640 |
gttaaattattaaactaatgatattttaaagtcttat |
42111604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University