View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_739 (Length: 202)
Name: NF10481A_low_739
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_739 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 11 - 183
Target Start/End: Complemental strand, 6715480 - 6715308
Alignment:
| Q |
11 |
gatggacatcacacgtggagtagtggcaaatggaagatgctgctttgtgtgtgctgagtcataatcaatattaaactatgtgcggtgtggtgaaaatatg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6715480 |
gatggacatcacacgtggagtagtggcaaatggaagatgctgctttgtgtgtgctgagtcataatcaatattaaactatgtgcggtgtggtgaaaatatg |
6715381 |
T |
 |
| Q |
111 |
gtgccttcacaattcagaatcagattcatttcattggtccatgtttttaggatctttcttctgcttcttcttc |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6715380 |
gtgccttcacaattcagaatcagattcatttcattggtccatgtttttaggatctttcttctgcttcttcttc |
6715308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University