View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10481A_low_739 (Length: 202)

Name: NF10481A_low_739
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10481A_low_739
NF10481A_low_739
[»] chr2 (1 HSPs)
chr2 (11-183)||(6715308-6715480)


Alignment Details
Target: chr2 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 11 - 183
Target Start/End: Complemental strand, 6715480 - 6715308
Alignment:
11 gatggacatcacacgtggagtagtggcaaatggaagatgctgctttgtgtgtgctgagtcataatcaatattaaactatgtgcggtgtggtgaaaatatg 110  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6715480 gatggacatcacacgtggagtagtggcaaatggaagatgctgctttgtgtgtgctgagtcataatcaatattaaactatgtgcggtgtggtgaaaatatg 6715381  T
111 gtgccttcacaattcagaatcagattcatttcattggtccatgtttttaggatctttcttctgcttcttcttc 183  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6715380 gtgccttcacaattcagaatcagattcatttcattggtccatgtttttaggatctttcttctgcttcttcttc 6715308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University