View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_78 (Length: 389)
Name: NF10481A_low_78
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_78 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 74; Significance: 8e-34; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 74; E-Value: 8e-34
Query Start/End: Original strand, 132 - 243
Target Start/End: Complemental strand, 8005735 - 8005631
Alignment:
| Q |
132 |
atgatcggttttccccagtgtgacggtggatcgacaaatttcattttcataaacaatggcgagtgaattaataacgctaacagtgcacttgggggtcggt |
231 |
Q |
| |
|
||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| | |
|
|
| T |
8005735 |
atgatcggttttccccaatgtgacgg-------acaaatttcattttcataaacaatggcgagtgaattaataacgttaacagtgcacttgggggtcgtt |
8005643 |
T |
|
| Q |
232 |
gtgattgccatg |
243 |
Q |
| |
|
|||||||||||| |
|
|
| T |
8005642 |
gtgattgccatg |
8005631 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000006; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 126 - 183
Target Start/End: Complemental strand, 9849235 - 9849178
Alignment:
| Q |
126 |
caatttatgatcggttttccccagtgtgacggtggatcgacaaatttcattttcataa |
183 |
Q |
| |
|
|||||||| || ||||||| ||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
9849235 |
caatttattattggttttcaccaatgtatcggtggatcgacaaatttcattttcataa |
9849178 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University