View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_85 (Length: 386)
Name: NF10481A_low_85
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_85 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 290; Significance: 1e-163; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 290; E-Value: 1e-163
Query Start/End: Original strand, 1 - 365
Target Start/End: Complemental strand, 30778751 - 30778387
Alignment:
| Q |
1 |
tcattttggtgtgatctttgactgcatggtgcaagtttgtgggttaggttttggcgtctttttgatttacgtttgataaagatgttaccttagtggagat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| | |||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
30778751 |
tcattttggtgtgatctttgactgcatggtgaaggtttgtgggttaggttttggcgtccttttgatttacgtttgataaaggtgttaccttagtggagat |
30778652 |
T |
|
| Q |
101 |
taggaggctagcatgggggattgataggctagggtaaccgtggaagaagacgtctccatgtgatttagttgtcggttgtttaaga-gtttggaaggacaa |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || | |||||||||||||||||||||||||||||||||||||||||||||| |||||||||| || |
|
|
| T |
30778651 |
taggaggctagcatgggggattgataggctaggatagcggtggaagaagacgtctccatgtgatttagttgtcggttgtttaagatatttggaaggataa |
30778552 |
T |
|
| Q |
200 |
gaatagtcgtatttttcgacatatagatcaatcgatacagcaaccggtgaacatcgtgaagttttcttcttttagatggttacaatcgaaaattaacaac |
299 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||| ||||||||||| |||||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
30778551 |
gaatagtcgtatttttcgacatataga-caatcgatacaacaaccggtgaatatcgtgaaattttcttcttttagatggttacaaccgaaaattaacaac |
30778453 |
T |
|
| Q |
300 |
ttagcctttgattttcatcatcggtggacaagcaaaaattgcaacttagcttttgattttcatcat |
365 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
30778452 |
ttagcttttgattttcatcatcggtggacaagcaaaaattgcaacgtagcttttgattttcatcat |
30778387 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University