View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_90 (Length: 382)
Name: NF10481A_low_90
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_90 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 102; Significance: 1e-50; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 276 - 377
Target Start/End: Complemental strand, 49293975 - 49293874
Alignment:
| Q |
276 |
ttaagtatatgtagatgtgtgaggaaaacataccgcaagcttgccggagccacggggaccgagaagaagaatagaattgttgcatgcttcagcgacggaa |
375 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49293975 |
ttaagtatatgtagatgtgtgaggaaaacataccgcaagcttgccggagccacggggaccgagaagaagaatagaattgttgcatgcttcagcgacggaa |
49293876 |
T |
|
| Q |
376 |
gt |
377 |
Q |
| |
|
|| |
|
|
| T |
49293875 |
gt |
49293874 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 84; E-Value: 8e-40
Query Start/End: Original strand, 135 - 218
Target Start/End: Complemental strand, 49294116 - 49294033
Alignment:
| Q |
135 |
ggaggcaaggaattaaaaattgaattgaataccactgaaatggagtctggatattgaatcaacaaatcttgaagaactagatcc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49294116 |
ggaggcaaggaattaaaaattgaattgaataccactgaaatggagtctggatattgaatcaacaaatcttgaagaactagatcc |
49294033 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 49294241 - 49294196
Alignment:
| Q |
20 |
catcacaatgtaaaagcccattcaacctaacctgcaaaaatccatg |
65 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49294241 |
catcacaatgtaaaagcccattcaacctaacctgcaaaaatccatg |
49294196 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University