View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481_high_4 (Length: 205)
Name: NF10481_high_4
Description: NF10481
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481_high_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 46 - 185
Target Start/End: Original strand, 5563392 - 5563531
Alignment:
| Q |
46 |
ggatcgtagagaccattttgagctggtgtaacacactcttcaagttcttcaacaaggaaggagagctgatggaaaaattgctcaagtctttctctgcact |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5563392 |
ggatcgtagagaccattttgagctggtgtaacacactcttcaagttcttcaacaaggaaggagagctgatggaaaaattgctcaagtctttctctgcact |
5563491 |
T |
 |
| Q |
146 |
caggatcttgcttcaacaaccaaggaaagtactttctatt |
185 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
5563492 |
caggatcttgcttcaacaaacaaggaaagtactttctatt |
5563531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University