View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481_low_3 (Length: 261)
Name: NF10481_low_3
Description: NF10481
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481_low_3 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 5337447 - 5337691
Alignment:
| Q |
1 |
tttacaatactccatcctttattcaaattcaggttcaaaatcagattccaatcttcaagtttaaacattctgctattcatcaatcaatatactccaacgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5337447 |
tttacaatactccatcctttattcaaattcaggttcaaaatcagattccaatcttcaagtttaaacattctgctattcatcaatcaatatactccaacgg |
5337546 |
T |
 |
| Q |
101 |
tggcagatgggaaaggttagtttcgttgacttcagcttatttactgtaac-nnnnnnncttcaagtttttcgctgacgctgattttaatattaaaattag |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5337547 |
tggcagatgggaaaggttagtttcgttgacttcagcttatttactgtaacttttttttcttcaagtttttcgctgacgctgattttaatattaaaattag |
5337646 |
T |
 |
| Q |
200 |
aaaaacgacgaacctgctgcttcttcttcatcatcttctgcttct |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5337647 |
aaaaacgacgaacctgctgcttcttcttcatcatcttctgcttct |
5337691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University