View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481_low_4 (Length: 249)
Name: NF10481_low_4
Description: NF10481
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481_low_4 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 14 - 249
Target Start/End: Complemental strand, 40023601 - 40023366
Alignment:
| Q |
14 |
gaaaaggatcatgagagagaaagacagagatggccaccctagggcaactgcatcggcattctccttcagtaacatgtaggttttacgggcggggaagggt |
113 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40023601 |
gaaaaggatcatgagagagaaagaaagagatggccaccctagggcaactgcatcggcattctccttcagtaacatgtaggttttacgggcggggaagggt |
40023502 |
T |
 |
| Q |
114 |
tctagttagggtgacataaataggggtgattggtctgaggtgagcaggcaacgacgaaaagcgatcagtccaggaagcacatgacatgacgagtttggta |
213 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
40023501 |
tctagttagagtgacataaatatgggtgattggtctgaggtgagcaggcaacgacaaaaagcgatcagtccaagaagcacatgacatgacgagtttggta |
40023402 |
T |
 |
| Q |
214 |
ggttcaagcgacaagaagggtatgacataggctacc |
249 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| |
|
|
| T |
40023401 |
ggttcaagcgacaagaaggttatgacataggctacc |
40023366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University