View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481_low_5 (Length: 231)
Name: NF10481_low_5
Description: NF10481
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481_low_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 11 - 216
Target Start/End: Complemental strand, 27315807 - 27315602
Alignment:
| Q |
11 |
cagagagaaatttgggtgtgtggaatgtgatgtttcgtgggttttgtgaaatgggttgtgtggaagttgaagagttgcttggattttacgctaggatgtg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27315807 |
cagagagaaatttgggtgtgtggaatgtgatgtttcgtgggttttgtgaaatgggttgtgtggaagttgaagagttgcttggattttacgctaggatgtg |
27315708 |
T |
 |
| Q |
111 |
ttttgaaggtgtagaagcaaatggggttactttttgttatttgcttagggggtgtagtagtaagagaaggtttcatgaaggggagatgattcatagctgt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27315707 |
ttttgaaggtgtagaagcaaatggggttactttttgttatttgcttagggggtgtagtagtaagagaaggtttcatgaaggggagatgattcatagctgt |
27315608 |
T |
 |
| Q |
211 |
gttttg |
216 |
Q |
| |
|
|||||| |
|
|
| T |
27315607 |
gttttg |
27315602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University