View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10482_high_10 (Length: 231)
Name: NF10482_high_10
Description: NF10482
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10482_high_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 14 - 222
Target Start/End: Complemental strand, 11874401 - 11874183
Alignment:
| Q |
14 |
aaagtcaacatgaaatataccaatagaagatccaaacaccaacaaca----------taaacagtagctagtaagcaaaacaattcactaactatgtaac |
103 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11874401 |
aaagtcaacataaaatataccaatagaagatccaaacaccaacaacaaaaaacaacataaatagtagctagtaagcaaaacaattcactaactatgtaac |
11874302 |
T |
 |
| Q |
104 |
atggctaaaacactgaagaagatttatccaccagtgatgaagttagttaactttggctgtgaannnnnnngcttgcagtcaacatgagtttatgcggtaa |
203 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
11874301 |
atggctaaaacactgaagatgatttatccaccagtgatgaagttagttaactttggttgtgaatttttttgcttgtagtcaacatgagtttatgcggtaa |
11874202 |
T |
 |
| Q |
204 |
atatctttgtttttcatct |
222 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
11874201 |
atatctttgtttttcatct |
11874183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University