View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10482_high_3 (Length: 305)
Name: NF10482_high_3
Description: NF10482
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10482_high_3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 11 - 140
Target Start/End: Complemental strand, 10470096 - 10469967
Alignment:
| Q |
11 |
gttggaggtcgtgaagttaatcctgtttgggaactcgctgatcaacataatctcaaaacgtgcttttctgattatagcaatgctcgcttcaacatctatg |
110 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10470096 |
gttggaggtcgtgaagctaatcctgtttgggaactcgctgttcaacataatctcaaaacgtgcttttctgattatagcaatgctcgcttcaacatctatg |
10469997 |
T |
|
| Q |
111 |
atcaaaggttcgtgaaattcatcacattca |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
10469996 |
atcaaaggttcgtgaaattcatcacattca |
10469967 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 189 - 286
Target Start/End: Complemental strand, 10469918 - 10469821
Alignment:
| Q |
189 |
acggtaatagttagttacggttacgattcgtagtgtagacgacgtcgtttcgatcggtgctgtattcgtttacggtaacggttctgaatatttgagga |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
10469918 |
acggtaatagttagttacggttacgattcgtagtgtagacgacgtcgtttcaatcggtgctgtatttgtttacggtaacggttctgaatatttgagga |
10469821 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University