View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10482_low_10 (Length: 250)
Name: NF10482_low_10
Description: NF10482
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10482_low_10 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 30 - 250
Target Start/End: Complemental strand, 3967329 - 3967105
Alignment:
| Q |
30 |
atacaatacaattgcaaaggcatgaagtcaaacaagttatttttagttttcagctaaaattatactc----taatggagcagcaaacttagcataaagag |
125 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
3967329 |
atacaatacaattgcaaaggcatgaagtcaagcaagttatttttagttttcagctaaaattatactcgatctaatggagcagcaaacttagcataaagag |
3967230 |
T |
|
| Q |
126 |
ggagataaagtttgatgacagaagagagagagcttccacaaataacatcaatttgaatatgaagaactcaaggatggtgtctttatttcaactatatatg |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3967229 |
ggagataaagtttgatgacagaagagagagagcttccacaaataacatcaatttgaatatgaagaactcaaggatggtgtctttatttcaactatatatg |
3967130 |
T |
|
| Q |
226 |
ctgctcaatatgtttgatcatcatc |
250 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
3967129 |
ctgctcaatatgtttgatcatcatc |
3967105 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University