View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10482_low_3 (Length: 316)

Name: NF10482_low_3
Description: NF10482
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10482_low_3
NF10482_low_3
[»] chr5 (1 HSPs)
chr5 (4-76)||(12559423-12559499)


Alignment Details
Target: chr5 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 4 - 76
Target Start/End: Original strand, 12559423 - 12559499
Alignment:
4 ttgttttttattcttgagtcaaaactcaaaaggcaattccactcagaatcaacc----ttgcatcatgatatataac 76  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||    |||||||||||||||||||    
12559423 ttgttttttatttttgagtcaaaactcaaaaggcaattccactcagaatcaaccttaattgcatcatgatatataac 12559499  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University