View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10482_low_3 (Length: 316)
Name: NF10482_low_3
Description: NF10482
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10482_low_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 4 - 76
Target Start/End: Original strand, 12559423 - 12559499
Alignment:
| Q |
4 |
ttgttttttattcttgagtcaaaactcaaaaggcaattccactcagaatcaacc----ttgcatcatgatatataac |
76 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
12559423 |
ttgttttttatttttgagtcaaaactcaaaaggcaattccactcagaatcaaccttaattgcatcatgatatataac |
12559499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University