View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10482_low_6 (Length: 271)
Name: NF10482_low_6
Description: NF10482
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10482_low_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 112; Significance: 1e-56; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 85 - 255
Target Start/End: Original strand, 10381042 - 10381212
Alignment:
| Q |
85 |
ttagtagatgaaactt-tttattttcttatgtatttgctggttcctttatatttagaagttttccaactagtatgactcggtgcaaatctaaaaattcat |
183 |
Q |
| |
|
||||||||||||| || |||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||| || | |||||||||||| ||| |
|
|
| T |
10381042 |
ttagtagatgaaatttctttattttcttatgtatttgctagttcctttatatttagaagttttccaaatagtatgactggg-gaaaatctaaaaatgcat |
10381140 |
T |
|
| Q |
184 |
atttaatatatattcatggtaatcaactatttaatatgtattcatgatatgcataatctcataagtaaaaag |
255 |
Q |
| |
|
||| |||||||||| ||||||||||||||||||||||||||||||||||| | |||||||||| |||||||| |
|
|
| T |
10381141 |
attcaatatatattgatggtaatcaactatttaatatgtattcatgatatacgtaatctcatacgtaaaaag |
10381212 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 11 - 85
Target Start/End: Original strand, 10380914 - 10380988
Alignment:
| Q |
11 |
cataggtaaatatcttttattttgaggtcaaattgccttgtatgtgatgacttccaaaactcctgcatcctttat |
85 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10380914 |
cataggtaaatatcttttatcttgaggtcaaattgtcttgtatgtgatgacttccaaaactcctgcatcctttat |
10380988 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University