View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10482_low_7 (Length: 256)
Name: NF10482_low_7
Description: NF10482
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10482_low_7 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 18 - 256
Target Start/End: Complemental strand, 38869037 - 38868799
Alignment:
| Q |
18 |
gtctgtgtcgccgatatgtccgtgtctgagacacgtaggtctagtttaagctatgcttctaaatgatcattattagagactacttcttgatagtaaggag |
117 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38869037 |
gtctgtgttgccgatatgtccgtgtctgagacacgtaggtctagtttaagctatgcttctaaatgatcattattagagactacttcttgatagtaaggag |
38868938 |
T |
 |
| Q |
118 |
agaattttccacttctggacttggcaactgctgttacttcctgcagcatattcaccactctgcgcattgaaggacggtttatgggaagagagcttgtgca |
217 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38868937 |
agaattttccacttctgaacttggcaactgctgttacttcctgcagcatattcaccactctgcgcattgaaggacggtttatgggaagagagcttgtgca |
38868838 |
T |
 |
| Q |
218 |
aagaagccctaccttgagaactttgcttatttcttcctt |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38868837 |
aagaagccctaccttgagaactttgcttatttcttcctt |
38868799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University