View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10482_low_9 (Length: 253)
Name: NF10482_low_9
Description: NF10482
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10482_low_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 244
Target Start/End: Complemental strand, 38868656 - 38868419
Alignment:
| Q |
1 |
ccaaagctataaatgtcactcttttcattcacccttagagtataaccatattctgcatcacataaatgaatccagacttagtttattactagtaacttta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
38868656 |
ccaaagctataaatgtcactcttttcattcaccctaagagtataaccatattctgcatcacataaatgaatccagactta------tactagtaacttta |
38868563 |
T |
|
| Q |
101 |
atatcagataaatcaataaattatttactaaaacaaaattgtaaagatagggaaatcaatgattaatgtattattagtactacctggtgcaatgtaacca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38868562 |
atatcagataaatcaataaattatttactaaaacaaaattgtaaagatagggaaatcaatgattaatgtattattagtactacctggtgcaatgtaacca |
38868463 |
T |
|
| Q |
201 |
caagatcctgcaatcatagacatgggttcttctatccctttgct |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
38868462 |
caagatcctgcaatcatagacatgggttcttctgtccctttgct |
38868419 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University