View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10486_low_15 (Length: 255)
Name: NF10486_low_15
Description: NF10486
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10486_low_15 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 139; Significance: 8e-73; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 18 - 164
Target Start/End: Original strand, 55080891 - 55081037
Alignment:
| Q |
18 |
agagagtgcctttagtgagtaggtgagcatggagtttcttgatggatgagagattattggttacttgacattggtgtaaatattgaattattaagttaga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
55080891 |
agagagtgcctttagtgagtaggtgagcatggagtttcttgatggatgagagattattggttacctgacattggtgtaaatattgaattattaagttaga |
55080990 |
T |
|
| Q |
118 |
catgtatgaaaaatgatatctatcaaggtgtcaaagtgcatgtatta |
164 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
55080991 |
catgtatgaaaaatgatatctatcaaggtgtgaaagtgcatgtatta |
55081037 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 201 - 235
Target Start/End: Original strand, 55081050 - 55081084
Alignment:
| Q |
201 |
tgacatgtaaatgtaaatgcctacttatatggttt |
235 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |
|
|
| T |
55081050 |
tgacatgtaaatgtaaatgcctaattatatggttt |
55081084 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University