View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10486_low_17 (Length: 250)
Name: NF10486_low_17
Description: NF10486
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10486_low_17 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 137 - 235
Target Start/End: Complemental strand, 14536864 - 14536766
Alignment:
| Q |
137 |
catggttgatgatgattgcagcaattgagttgagtaaaggagcaattgaaggcattgagattgagttcattgatatttcaactctacctatgtataaca |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14536864 |
catggttgatgatgattgcagcaattgagttgagtaaaggagcaactgaaggcattgagattgagttcattgatatttcaactctacctatgtataaca |
14536766 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 1 - 73
Target Start/End: Complemental strand, 14537000 - 14536928
Alignment:
| Q |
1 |
ggcagctctttctggttccatcagaaaagtttcataccattcaggccttatccgtgctggttcgatcttcgtc |
73 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14537000 |
ggcagctctttctggttccatcagaaaagtttcataccattcaggccttatccgtgctggttcgatcttcgtc |
14536928 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University