View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10486_low_18 (Length: 244)
Name: NF10486_low_18
Description: NF10486
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10486_low_18 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 3364603 - 3364396
Alignment:
| Q |
1 |
cgagaatgaaatgattaaaagattcaagtatctatctactactatactcgtttcaacatatatgtggtaggatcattcaaggagtaaataaaattggcnn |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||| ||| |
|
|
| T |
3364603 |
cgagaatgaaatgattaaaagattcaagtatctatctactactatactcgtttcaacatatatgtggtaggatcattg-----gcaaaaaaa-------- |
3364517 |
T |
|
| Q |
101 |
nnnnntcatgtagaaattcataaaatcacatagactatttaagatcaatccaaaacatataaactacatgatgaaggaatattaacaaacctgggtgtgc |
200 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
3364516 |
-----tcatgtagaaattcataaaaccacatagactatttaagatcaatccaaaacatataaactacatgatgaaggaaaattaacaaacctaggtgtgc |
3364422 |
T |
|
| Q |
201 |
tcatccttatcaagagcttttcatat |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
3364421 |
tcatccttatcaagagcttttcatat |
3364396 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University