View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10486_low_21 (Length: 239)
Name: NF10486_low_21
Description: NF10486
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10486_low_21 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 12 - 220
Target Start/End: Complemental strand, 44315957 - 44315749
Alignment:
| Q |
12 |
ctttctccgtagcgttgctatgctcataaatgagtagtaaagagaaatgctatcagtacagtgacactataatgcttagcccagttaagtagaaaaatag |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
44315957 |
ctttctccgtagcgttgctatgctcataaatgagtagtaaagagaaatgctatcagtacagtgacactataatgcttagcccaattaagtagaaaaatag |
44315858 |
T |
 |
| Q |
112 |
ttttgttatattgagattgactcttgctcttggaggatgctaaaacatttaggcattgaatcaccaaatgcacgagttatggacactattcaatggttgt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44315857 |
ttttgttatattgagattgactcttgctcttggaggatgctaaaacatttagactttgaatcaccaaatgcacgagttatggacactattcaatggttgt |
44315758 |
T |
 |
| Q |
212 |
ttgaacact |
220 |
Q |
| |
|
||||||||| |
|
|
| T |
44315757 |
ttgaacact |
44315749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University