View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10486_low_24 (Length: 228)
Name: NF10486_low_24
Description: NF10486
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10486_low_24 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 228
Target Start/End: Complemental strand, 38454649 - 38454422
Alignment:
| Q |
1 |
gcaaaccactttaccctgtactgtagtttgttttctgtgttggtagaaagtagcaacgttatgtaccnnnnnnnnngtagaaacgttgctattatttatt |
100 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||| |||||||||||||||||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
38454649 |
gcaaaccactttactctgtactgtagtttcttttctctgttggtagaaagtagcaacgttatgtaccaaaaaaaaagtagcaacgttgctattatttatt |
38454550 |
T |
 |
| Q |
101 |
tattttaattaatgctcttctgtgttggtagaggcatcatacgatggtttatattgattttggtttttattaattatctgcatatgtttcccatacttct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38454549 |
tattttaattaatgctcttctgtgttggtagaggcatcatacgatggtttatattgattttggtttttattaattatctgcatatgtttcccatacttct |
38454450 |
T |
 |
| Q |
201 |
ctcttcccttgcttgttagaacttagaa |
228 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
38454449 |
ctcttcccttgcttgttagaacttagaa |
38454422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University