View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10487_low_4 (Length: 216)
Name: NF10487_low_4
Description: NF10487
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10487_low_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 52 - 201
Target Start/End: Original strand, 10469020 - 10469171
Alignment:
| Q |
52 |
taattgaagatatgattaaagag--tcacaacagaacgaaacacataacaaaatcgttttaacggctgaaaacgacatgaaaagaatttgcacttacaat |
149 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10469020 |
taattgaagatatgattaaagagagtcacaacagaacgcaacacataacaaaatcgttttaacggctgaaaacgacatgaaaagaatttgcacttacaat |
10469119 |
T |
|
| Q |
150 |
gacggtttcgttactttgttgccatcatcattggcttcttcatcatcttctt |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10469120 |
gacggtttcgttactttgttgccatcatcattggcttcttcatcatcttctt |
10469171 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University