View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10488_high_22 (Length: 203)
Name: NF10488_high_22
Description: NF10488
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10488_high_22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 18 - 188
Target Start/End: Original strand, 27807777 - 27807947
Alignment:
| Q |
18 |
ctttaggccagtctgcaccaagcatgattgcatttacaaaggcaagagttgctgctgcgaaaattttcggtgtgatcgatcacaagccttgtatagacaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
27807777 |
ctttaggccagtctgcaccaagcatgattgcatttacaaaggcaagagttgctgctgcgaaaatcttcggtgtgatcgatcacaagccttgtatagacaa |
27807876 |
T |
 |
| Q |
118 |
gaaaagtgaatcaggtttggagttagaaactgtgacaggactagtggagcttaaaaatgtagacttttcat |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27807877 |
gaaaagtgaatcaggtttggagttagaaactgtgacaggactagtggagcttaaaaatgtagacttttcat |
27807947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 35; Significance: 0.00000000007; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 29 - 183
Target Start/End: Complemental strand, 41178393 - 41178239
Alignment:
| Q |
29 |
tctgcaccaagcatgattgcatttacaaaggcaagagttgctgctgcgaaaattttcggtgtgatcgatcacaagccttgtatagacaagaaaagtgaat |
128 |
Q |
| |
|
|||||||| |||||| ||||||||||||||| |||||||| ||||| || |||||| | | || |||||| ||||| ||||||| | || ||||||| |
|
|
| T |
41178393 |
tctgcaccgagcatggctgcatttacaaaggctagagttgcggctgctaagattttccggataattgatcaccagcctggtatagatagaaacagtgaat |
41178294 |
T |
 |
| Q |
129 |
caggtttggagttagaaactgtgacaggactagtggagcttaaaaatgtagactt |
183 |
Q |
| |
|
| || ||||| ||||| || || || ||||| || || || |||||||| ||||| |
|
|
| T |
41178293 |
ctggattggaattagagacagttactggacttgttgaactgaaaaatgtggactt |
41178239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University