View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10488_low_14 (Length: 390)
Name: NF10488_low_14
Description: NF10488
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10488_low_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 61; Significance: 4e-26; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 134 - 209
Target Start/End: Complemental strand, 45342415 - 45342337
Alignment:
| Q |
134 |
acaaaatcgacggttattctttgttttcattttcac---tatcacatgatgtgatatgtgatatatatattatgacaca |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
45342415 |
acaaaatcgacggttattctttgttttcattttcactaatatcacatgatgtgatgtgtgatatatatattatgacaca |
45342337 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 274 - 333
Target Start/End: Complemental strand, 45342272 - 45342214
Alignment:
| Q |
274 |
tactctaagaaaccttcacatggaaccgcaacgtgttatcgtccttttcaccgtcatcac |
333 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||| ||||| || ||||||||||||| |
|
|
| T |
45342272 |
tactctaagaa-ccttcacatggaaccgcaacgtgttgtcgtcattgtcaccgtcatcac |
45342214 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 19 - 57
Target Start/End: Complemental strand, 45342531 - 45342493
Alignment:
| Q |
19 |
agatttgtcactaaaacaagtttgacaatcaacgcttca |
57 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
45342531 |
agatttgtcactaaaacaagtttgacaatcaactcttca |
45342493 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University