View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10488_low_27 (Length: 240)
Name: NF10488_low_27
Description: NF10488
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10488_low_27 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 1 - 95
Target Start/End: Original strand, 10086834 - 10086928
Alignment:
| Q |
1 |
ttttggttctgctcataaccttatagccacttcccttgattcccagggtaatgaaaatcaaaacttttaaccttttttagcatgcccatttatca |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10086834 |
ttttggttctgctcataaccttatagccacttcccttgattcccagggtaatgaaaatcaaaacttttaaccttttttagcatgcccatttatca |
10086928 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 133 - 225
Target Start/End: Original strand, 10086966 - 10087058
Alignment:
| Q |
133 |
ggcagagaaaattgaaaagaagtatagtaatggaatgagtaatgcaagggaacttgaagaaagaggttgtattgttctttatgatgttgatgt |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
10086966 |
ggcagagaaaattgaaaagaagtatagtaatggaatgagtaatgcaagggaacttgaagaaaggggttgtattgttctttatgatgttgatgt |
10087058 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University