View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10489_high_11 (Length: 290)
Name: NF10489_high_11
Description: NF10489
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10489_high_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 5 - 275
Target Start/End: Complemental strand, 39779717 - 39779447
Alignment:
| Q |
5 |
tcgagagagatgaataaaagtaatgaatgctttgatcagaggcctatctgaccattgcccagtctcattaccatcgatgaggagaattgaggtcctagtc |
104 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| | ||| |
|
|
| T |
39779717 |
tcgatagagatgaataaaagtaatgaatgctttgatcagaggactatctgaccattgcccagtctcattaccatcgatgaggagaattgaggtcgtcgtc |
39779618 |
T |
 |
| Q |
105 |
ctcaatgtatgtggaaatattgggcggatcttctaggttataagaaatttgttcaaaaacaatggcactctcatacgtggatggttggggagaatttgta |
204 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39779617 |
ctcaatgtatgttgaaatattgggcggatcttctaggttataagaaatttgttcaaaaacaatggcactctcatacgtggatggttggggagaatttgta |
39779518 |
T |
 |
| Q |
205 |
ctaaaggaaaaactcaaaaagattaaaggtagtttgagaacttggaaccaagatcacaattaaaatcttga |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39779517 |
ctaaaggaaaaactcaaaaagattaaaggtagtttgagaacttggaaccaagatcacaattaaaatcttga |
39779447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University