View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10489_high_15 (Length: 252)
Name: NF10489_high_15
Description: NF10489
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10489_high_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 236; Significance: 1e-130; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 1 - 244
Target Start/End: Complemental strand, 34139828 - 34139585
Alignment:
| Q |
1 |
cgagttgtggatgttggaggaggaactggattcactactcttggtatagtgaagcatgttgatgctaaaaatgttacaattcttgatcagtctcctcatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34139828 |
cgagttgtggatgttggaggaggaactggattcactactcttggtatagtgaagcatgttgatgctaaaaatgttacaattcttgatcagtctcctcatc |
34139729 |
T |
 |
| Q |
101 |
agcttgctagggctaagaagaaggaagcattgaaagaatgtaagataattgaaggcgatgcagaagatcttccatttccaactgattatgccgaccgata |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
34139728 |
agcttgctagggctaagaagaaggaagcattgaaagaatgtaagataattgaaggcgatgcagaagatcttccatttccaactgattatgctgaccgata |
34139629 |
T |
 |
| Q |
201 |
tgtatctgctggaaggtattgtgttgtcacagttctttcttctc |
244 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34139628 |
tgtttctgctggaaggtattgtgttgtcacagttctttcttctc |
34139585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 4 - 219
Target Start/End: Original strand, 31517325 - 31517540
Alignment:
| Q |
4 |
gttgtggatgttggaggaggaactggattcactactcttggtatagtgaagcatgttgatgctaaaaatgttacaattcttgatcagtctcctcatcagc |
103 |
Q |
| |
|
||||| |||||||| || || ||||| |||||||| | ||||| || |||||||| |||||||| ||||| || |||||||||||||| |||||||||| |
|
|
| T |
31517325 |
gttgttgatgttggtggtggtactggtttcactacattgggtattgttaagcatgtcgatgctaagaatgtgactattcttgatcagtcacctcatcagc |
31517424 |
T |
 |
| Q |
104 |
ttgctagggctaagaagaaggaagcattgaaagaatgtaagataattgaaggcgatgcagaagatcttccatttccaactgattatgccgaccgatatgt |
203 |
Q |
| |
|
|||||| |||||| | ||||| | | || || ||||| || ||||||| ||||| |||||| | || |||| |||||||||||| || ||||||| |
|
|
| T |
31517425 |
ttgctaaagctaaggaaaaggagccgcttaaggattgtaaaattgttgaaggggatgctgaagatttaccctttcgaactgattatgctgatagatatgt |
31517524 |
T |
 |
| Q |
204 |
atctgctggaaggtat |
219 |
Q |
| |
|
|| |||||||||||| |
|
|
| T |
31517525 |
gtccgctggaaggtat |
31517540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University