View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10489_high_16 (Length: 250)
Name: NF10489_high_16
Description: NF10489
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10489_high_16 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 37210091 - 37210310
Alignment:
| Q |
1 |
gttgtacaaatatcatttatgttatcttttgtatgttgggataaaaagagttgttgagggaatgggacaaattagattgtactatgaaggagtttgcgtg |
100 |
Q |
| |
|
||||||| |||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
37210091 |
gttgtacgaatatcatttctcttatcttttgtatgttgggataaaaagagttgttgagggaatgggacaaattagattgtactatgaaggagtatgcgtg |
37210190 |
T |
|
| Q |
101 |
ttgggtgggtgagaccgttgcaaaggttgtatttgtaaccaaatacagaaagnnnnnnnnnggagggaatggaccacatgctaaacatacccaaaaatgg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37210191 |
ttgggtgggtgagaccgttgcaaaggttgtatttgtaaccaaatacagaaa-----aaaaaggagggaatggaccacatgctaaacatacccaaaaatgg |
37210285 |
T |
|
| Q |
201 |
aaaagaatttattacctttatcttt |
225 |
Q |
| |
|
|||||||||||||| |||||||||| |
|
|
| T |
37210286 |
aaaagaatttattatctttatcttt |
37210310 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 164 - 204
Target Start/End: Original strand, 40556769 - 40556809
Alignment:
| Q |
164 |
agggaatggaccacatgctaaacatacccaaaaatggaaaa |
204 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
40556769 |
agggaatggaccacatgttaaacatacccaaaaatggaaaa |
40556809 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University