View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10489_low_26 (Length: 238)
Name: NF10489_low_26
Description: NF10489
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10489_low_26 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 111; Significance: 4e-56; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 95 - 213
Target Start/End: Complemental strand, 28143573 - 28143455
Alignment:
| Q |
95 |
gattgactaattctttattcaaccccatttttaaattatgaaaacctcatttgctagtcggtataatttatttcagttattttgttgaacattctttggt |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
28143573 |
gattgactaattctttattcaaccccatttttaaattatgaaaacctcatttgctagtcggtatagtttatttcagttattttgttcaacattctttggt |
28143474 |
T |
 |
| Q |
195 |
caatactcaatagatcctt |
213 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
28143473 |
caatactcaatagatcctt |
28143455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University