View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10489_low_29 (Length: 214)
Name: NF10489_low_29
Description: NF10489
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10489_low_29 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 19 - 176
Target Start/End: Complemental strand, 108661 - 108504
Alignment:
| Q |
19 |
atgtaaatcttcgtttgcattagatggatcgtcaaaaacaagtatggaaaaagagatatatctcctcacatcttcttgttctcatttattaggctaattt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
108661 |
atgtaaatcttcgtttgcattagatggatcgtcaaaaacaagtatggaaaaagagatatatctcctcacatcttcttgttctcatttattaggctaattt |
108562 |
T |
 |
| Q |
119 |
ttgggacaatttgtacactgtgtctctcttgtatacttatttgattacaatcaagcca |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
108561 |
ttgggacaatttgtacactgtgtctctcttgtatacttatttgattacaatcaagcca |
108504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University