View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1048_high_26 (Length: 492)
Name: NF1048_high_26
Description: NF1048
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1048_high_26 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 283; Significance: 1e-158; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 67 - 485
Target Start/End: Original strand, 55101432 - 55101825
Alignment:
| Q |
67 |
attagtaatataataacactcctaacctaacaatcagtggataacgggcttctcgatattatttgacttgacacacaaacttctattaataaataaaaca |
166 |
Q |
| |
|
||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55101432 |
attagtactataataacactcctaac-----aatcagtggataacgggcttctcgatattatttgacttgacacacaaacttctatt------------- |
55101513 |
T |
 |
| Q |
167 |
cattattctctgtctcatattctttgtagggaaaaaatgatgctaactgttcaccgtgtatatctttctgctgtacttaagttgattttgttaattacta |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55101514 |
---------ctgtctcatattctttgtagggaaaaaatgatgctaactgttcaccgtgtatatctttctgctgtacttaagttgattttgttaattacta |
55101604 |
T |
 |
| Q |
267 |
ctctctgcactttatcaggtgctgcatgcacttctccttcttctgccacttctattctattctgttcttgctaatttgacttttaa--tannnnnnnngc |
364 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | || |
|
|
| T |
55101605 |
ctctctgcactttatcaggtgctgcatgcacttctccttcttctgccacttctattctattctgttcttgctaatttgacttttaattttttttttttgc |
55101704 |
T |
 |
| Q |
365 |
tcatttcacacttgtatgcagattgctatgaccctttggatccaaatgggaacatttctgtaacatttgacatttaccaacgtatggaaaatggatatct |
464 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55101705 |
tcatttcacacttgtatgcagattgctatgaccctttggatccaaatgggaacatttctgtaacatttgacatttaccaacgtatggaaaatggatatct |
55101804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University