View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1048_high_51 (Length: 261)
Name: NF1048_high_51
Description: NF1048
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1048_high_51 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 33 - 257
Target Start/End: Original strand, 54734408 - 54734632
Alignment:
| Q |
33 |
aaaagattttgaactatctttttcattaatgataatttgttattcagaagaattgcaattgcaaagacgagaccgcacaagactggtttgcttattgcca |
132 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
54734408 |
aaaagattttgaactatctttttcattaatgataatttgttattcagaagaattgcaattgcaaagacgagaccgcacaagactggtttgcttattggca |
54734507 |
T |
 |
| Q |
133 |
gtcaagttttgcatgatctgtgcttgtttccaactctgcataagctggctgccacaactccaaacctgctaagatatttcagtggtgtgctccaaaacct |
232 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54734508 |
gtctagttttgcatgatctgtgcttgtttccaactctgcataagctggctgccacaactccaaacctgctaagatatttcagtggtgtgctccaaaacct |
54734607 |
T |
 |
| Q |
233 |
tccttttctttgcatccaaatccta |
257 |
Q |
| |
|
||||||||||||| ||||||||||| |
|
|
| T |
54734608 |
tccttttctttgcgtccaaatccta |
54734632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University