View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1048_high_54 (Length: 222)
Name: NF1048_high_54
Description: NF1048
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1048_high_54 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 73; Significance: 2e-33; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 137 - 213
Target Start/End: Original strand, 29009481 - 29009557
Alignment:
| Q |
137 |
agggttttcgcgcctttatacagagtgatgagaattttggtttcgttttctgttatggagagtaaacttgtctgtgg |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
29009481 |
agggttttcgcgcctttatacagagtgatgagaattttggtttcgttttctgttacggagagtaaacttgtctgtgg |
29009557 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University