View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1048_high_56 (Length: 215)
Name: NF1048_high_56
Description: NF1048
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1048_high_56 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 96; Significance: 3e-47; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 1 - 137
Target Start/End: Complemental strand, 31835588 - 31835452
Alignment:
| Q |
1 |
tgaaatagtacaattagattttgtattttgttagnnnnnnnattaaagtattgcttaggtatttagattttgtaaattacttcacttattggagtatggt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
31835588 |
tgaaatagtacaattagattttgtattttgttagtttttttattaaagtattgcttaggtatttagattttgtaaattacttcgcttattggagtatggt |
31835489 |
T |
|
| Q |
101 |
caaatctctttttagtacttcttccatcctatattat |
137 |
Q |
| |
|
|| || ||||||||||||||||||| | ||||||||| |
|
|
| T |
31835488 |
catatttctttttagtacttcttccgttctatattat |
31835452 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University