View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1048_low_60 (Length: 275)

Name: NF1048_low_60
Description: NF1048
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1048_low_60
NF1048_low_60
[»] chr7 (1 HSPs)
chr7 (167-243)||(32875016-32875092)


Alignment Details
Target: chr7 (Bit Score: 77; Significance: 8e-36; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 167 - 243
Target Start/End: Complemental strand, 32875092 - 32875016
Alignment:
167 catcaccaccaacattaacccttggacgattaactagttgagagggtttcattatacatccattgctaatctctctg 243  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32875092 catcaccaccaacattaacccttggacgattaactagttgagagggtttcattatacatccattgctaatctctctg 32875016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University