View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1048_low_66 (Length: 262)
Name: NF1048_low_66
Description: NF1048
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1048_low_66 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 28 - 262
Target Start/End: Original strand, 19074336 - 19074569
Alignment:
| Q |
28 |
cataactcacacattaagccatgtgataagagttgagctagatattttccttccaacttctgtaagatggtttccagttgaatactaatatgtttgtttc |
127 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
19074336 |
cataagtcacacattaagccatgtgataagagttgagatagatattttccttccaacttctgtaagatggtttccagtagaaaactaatatgtttgtttc |
19074435 |
T |
|
| Q |
128 |
tagctaattaaggcatatcatgtgtatccatgtcgatcatatctcttttcttttgaacaagtccctcattgctttatgagaggtactcattcaagggcat |
227 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19074436 |
tagctaat-aaggcatatcatgtgtatccatgtcgatcatatctcttttcttttgaacaagtccctcattgctttatgagaggtactcattcaagggcat |
19074534 |
T |
|
| Q |
228 |
tttgtcaatcaactctcttacttctctagccattt |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
19074535 |
tttgtcaatcaactctcttacttctctagccattt |
19074569 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University