View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1048_low_69 (Length: 253)
Name: NF1048_low_69
Description: NF1048
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1048_low_69 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 139 - 226
Target Start/End: Complemental strand, 36386497 - 36386410
Alignment:
| Q |
139 |
tattaattagaattttcttatgtagtgcacatcaccactattatcactcatgttgaaggtgtatgataaaacatttataatttttgtc |
226 |
Q |
| |
|
|||||||||||||||||||||||| | | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36386497 |
tattaattagaattttcttatgtactccgcatcaccactattatcactcatgttgaaggtgtatgataaaacatttataatttttgtc |
36386410 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 78 - 125
Target Start/End: Complemental strand, 17641497 - 17641450
Alignment:
| Q |
78 |
aagctaggttctgggatgaatgaaattataaaatgtgtgaaattacta |
125 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17641497 |
aagcaaggtcctgggatgaatgaaattataaaatgtgtgaaattacta |
17641450 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 84 - 123
Target Start/End: Complemental strand, 22362839 - 22362800
Alignment:
| Q |
84 |
ggttctgggatgaatgaaattataaaatgtgtgaaattac |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22362839 |
ggttctgggatgaatgaaattataaaatgtgtgaaattac |
22362800 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 83 - 125
Target Start/End: Original strand, 14106833 - 14106875
Alignment:
| Q |
83 |
aggttctgggatgaatgaaattataaaatgtgtgaaattacta |
125 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
14106833 |
aggttcttggatgaatgaaattataaaatgtgtgaaattacta |
14106875 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 75 - 125
Target Start/End: Complemental strand, 29322056 - 29322007
Alignment:
| Q |
75 |
agaaagctaggttctgggatgaatgaaattataaaatgtgtgaaattacta |
125 |
Q |
| |
|
||||||| ||||||||| | ||||||||||||||||||||||||||||||| |
|
|
| T |
29322056 |
agaaagcaaggttctggaa-gaatgaaattataaaatgtgtgaaattacta |
29322007 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University